Use of P-FILM™ for Protein‑DNA Complex Identification

 

Introduction

 

The gel shift, or electrophoretic mobility shift assay (EMSA) is used in the study of DNA – protein interactions. Traditionally, gel shift assays involve combining a protein (e.g., in vitro synthesized) or mixture of proteins (e.g., a nuclear extract) with a radioactively labeled DNA fragment containing a putative protein-binding site. After incubation, the mixture is separated on a non-denaturing polyacrylamide gel1 and the gel is dried and exposed to x-ray film. Free DNA fragments move through the gel more quickly than complexes of protein and DNA. Therefore, protein-DNA complexes can be distinguished from free DNA by their relative positions on the gel. Thus, the gel-shift assay indicates the ability of a protein(s) to bind a particular nucleic acid sequence. A number of modifications to this technique have been added over time. For example, to evaluate the specificity of the nucleic acid-protein binding, competition experiments are performed. Competitors may be either the nucleic acid with the binding sequence of interest or other unrelated nucleic acid sequences. Additionally, to determine the identity of protein(s) in the complex, a known antibody can be added to the mixture. If the particular target of that antibody is present in the complex, the complex that forms will increase in size (relative to the sample without antibody added). As a result, the original band will ‘shift’ even higher. In this so-called ‘super-shift’ assay, binding of the antibody results in further retardation of the band through the gel (Figure 1).

 

Figure 1. Schematic of gel shift and super-shift assays. Panel A: Unbound DNA (lane 1 and lane 2) Panel B: Unbound DNA (lane 1) and DNA-protein complex (lane 2) Panel C: Super-shift. Unbound DNA (lane 1) and DNA-protein complex (lane 2) and DNA-protein-antibody complex (lane 3)

 

 

 

 

 

 

 

 

 

The main problem with identifying proteins in DNA - protein complexes this way is assuring specificity of the antibody binding. Most antibodies are made to recognize denatured proteins, but proteins used in the gel shift assay are in their native form. This can result in a number of non-specific interactions or lack of recognition at all. Also, not more then one antibody can be added to the reaction meaning that if numerous members of the complex are to be identified, separate reactions must be performed for every antibody tested.We have applied 20/20 GeneSystems’ P-FILM (Protein Function Identification Layered Membranes; Figure 2) to gel shift and super-shift assays. After transfer of the proteins from the gel to the membrane stack, different proteins within the complexes can be analyzed on each membrane through use of specific antibodies.  Thus by using P-FILM technology, in a single gel-shift experiment, multiple proteins can be tested for their ability to bind DNA and identified based on their immune properties.

 

Text Box: Figure 2. P-FILM for protein analysis. P-FILM consists of a stack of multiple thin membranes. Proteins and other biomolecules are transferred to the stack and a distributed among them. The resultant blots may each be probed with a different antibody. Conventional transfer apparatus and protocols are used. For more information, see www.2020gene.com

 

 

 

 

 

 

 

 

 

 

 

 


 

 

 

 

 

 

Experimental Procedure

 

P-FILM was used to analyze the binding interactions the transcription factor, his6-CREB and a protein co-factor, his6-c-rel with a specific DNA sequence. Both proteins were tagged with his-tag and synthesized in vitro (his6-CREB and his6-c-rel).  250 ng of recombinant his6-c-rel was incubated alone and with 120 ng of purified recombinant his6-CREB in combination with 0.2 ng of 32P 5’ labeled duplex oligonucleotide encoding the sequence 5’TCGACCTCTTCTGATGACTCTTTGGAATTTCTTTAAACCCCCA 3’(SEQ ID NO.:1), in 10 μul of buffer containing 10 mM Hepes, 50 mM NaCl, 20% glycerol, 4 mM b-mercaptoethanol.  The reaction was allowed to proceed at room temperature for 30 minutes.  Samples were then separated by electrophoresis on a 4% polyacrylamide gel at 180 Volts for 1 hour, transferred in 25 mM TRIS,192 mM glycine, 0.025% SDS and 20% methanol (60-110 V for 1-2 hours) through a stack of 4 P-FILM membranes followed by an NA45 DEAE (Schleicher & Schuell) membrane.  This last layer of charged cellulose was used to trap all of the DNA released from the gel.  After transfer, registration marks were made with a 19G needle and the DEAE membrane was dried down and exposed overnight to a phosphoimager screen and visualized on a Phosphorimager: SI (Molecular Dynamics).  The first and second P-FILM membranes were rinsed in TBST buffer, blocked for 10-60 minutes in 1x casein solution (Vector Laboratories, Inc.) and incubated overnight at 4°C in anti-rel (1:200, Dr. Kevin Gardner) and anti-His (1:10,000, Stratagene) antibody, washed in TBST, incubated in the complex of secondary antibody and alkaline phosphatase, and washed again. The location of the protein was visualized by ECL (DuoLux, Vector Laboratories, Inc.) and Biomax MR film (Kodak).   Images of all of the membranes were aligned in Adobe Photoshop (Figure 3). 

 

REsults and Conclusion

 

Figure 3 shows the results obtained with P-FILM in a gel-shift assay. On the first membrane, probed with anti-Rel antibody, binding is observed in both lanes. The second membrane shows strong binding of the anti-CREB antibody in lane 1 but no binding in lane 2. This shows the specificity of the antibody reaction (the sample in lane 2 did not contain CREB protein).

 

Figure 3.  Application of P-FILM to Protein-DNA binding interactions Binding interactions of his6-CREB and his6-c-rel and his6-CREB with a specific DNA sequence.

 

These data show that P-FILM used in a multi-membrane format provides an attractive alternative to a gel super-shift assay. Firstly, binding of the antibody to the appropriate protein is likely to be better. This is because antibodies are generally designed to bind to denatured proteins and super-shift assays are traditionally performed with native proteins (on non-denaturing gels).  Furthermore, use of multiple membranes allows the study of numerous protein-protein interactions on the same sample through use of specific antibodies, not possible with traditional EMSA assays.  P-FILM provides a time-saving elegant method for the study of DNA-protein interactions. It should be noted that all experiments performed to date have used in vitro synthesized proteins; thus far we have not performed experiments using cell nuclear extracts (sensitivity of this assay for cell extracts would have to be determined by investigators for their experimental conditions).

 

1. Garner M.M. et al. Nucl. Acid Res. 9, pp 3047-3060 (1981)

 

Acknowledgement

20/20 GeneSystems is grateful for the valuable contributions of Mrs. Cynthia Haggerty and Dr. Kevin Gardner from the National Cancer Institute, 8717 Grovemont Circle , Gaithersburg MD 20892-4605 to this work.